Imprinted Gene Databases

Homo sapiens: SLC38A4

Solute carrier family 38, member 4
Species Gene Aliases Location Status Expressed Allele
Homo sapiens SLC38A4 ATA3, NAT3, PAAT, FLJ10191, MGC126876  12:47148543-47229779  Unknown Unknown
Mus musculus Slc38a4 At, SN, Ata3, SNAT4, mATA3, mNAT3, 1110012E16Rik, 1700012A18Rik  15:96882700-96963836  Imprinted Paternal
Sus scrofa SLC38A4   5:80383377-80445176  Imprinted Isoform Dependent
Bos taurus SLC38A4 Ata3  5:33609908-33664582  Not Imprinted Biallelic
1      actggggtgtgcgcagcgcctggagcatgagccgggtggtggcgtgcacggaggatcgcg     60
       ............................................................
61     ggaggctgccgcctcgggacaccccactcacacagagctgacgcaagttggacagaagga    120
       ............................................................
121    ggtgttggggtgaggtggtggtgttgattggcttgtctcgttcactcccactggtcttta    180
       ............................................................
181    aatcaatgtctagatctctaaagtttcatataaatcaaagctgttacacgggtctgccat    240
       ............................................................
241    tccaaacaagtcaggaaagcctgcacaggactggataaataattaagaacagagtgttct    300
       ............................................................
301    gaacatcaacacaaagtggaagaaccttaagctgaaggtacagtatattatttacactga    360
       ............................................................
361    aggggcttgtgtgtggacaagaaagcgctgacagctcaaATGGATCCCATGGAACTGAGA    420
       .......................................M--D--P--M--E--L--R--
421    AATGTCAACATCGAACCAGATGATGAGAGCAGCAGTGGAGAAAGTGCTCCAGATAGCTAC    480
       N--V--N--I--E--P--D--D--E--S--S--S--G--E--S--A--P--D--S--Y--
481    ATCGGGATAGGAAATTCAGAAAAGGCAGCAATGAGCAGTCAATTTGCTAATGAAGACACT    540
       I--G--I--G--N--S--E--K--A--A--M--S--S--Q--F--A--N--E--D--T--
541    GAAAGTCAGAAATTCCTGACAAATGGATTTTTGGGGAAAAAGAAGCTGGCAGATTATGCT    600
       E--S--Q--K--F--L--T--N--G--F--L--G--K--K--K--L--A--D--Y--A--
601    GATGAACACCATCCCGGAACCACTTCCTTTGGAATGTCTTCATTTAACCTGAGTAATGCC    660
       D--E--H--H--P--G--T--T--S--F--G--M--S--S--F--N--L--S--N--A--
661    ATCATGGGCAGTGGGATCCTGGGCTTGTCCTATGCCATGGCCAACACAGGGATCATACTT    720
       I--M--G--S--G--I--L--G--L--S--Y--A--M--A--N--T--G--I--I--L--
721    TTTATAATCATGCTGCTTGCTGTGGCAATATTATCACTGTATTCAGTTCACCTTTTATTA    780
       F--I--I--M--L--L--A--V--A--I--L--S--L--Y--S--V--H--L--L--L--
781    AAAACAGCCAAGGAAGGAGGGTCTTTGATTTATGAAAAATTAGGAGAAAAGGCATTTGGA    840
       K--T--A--K--E--G--G--S--L--I--Y--E--K--L--G--E--K--A--F--G--
841    TGGCCGGGAAAAATTGGAGCTTTTGTTTCCATTACAATGCAGAACATTGGAGCAATGTCA    900
       W--P--G--K--I--G--A--F--V--S--I--T--M--Q--N--I--G--A--M--S--
901    AGCTACCTCTTTATCATTAAATATGAACTACCTGAAGTAATCAGAGCATTCATGGGACTT    960
       S--Y--L--F--I--I--K--Y--E--L--P--E--V--I--R--A--F--M--G--L--
961    GAAGAAAATACTGGAGAATGGTACCTCAATGGCAACTACCTCATCATATTTGTGTCTGTT   1020
       E--E--N--T--G--E--W--Y--L--N--G--N--Y--L--I--I--F--V--S--V--
1021   GGAATTATTCTTCCACTTTCGCTCCTTAAAAATTTAGGTTATCTTGGCTATACCAGTGGA   1080
       G--I--I--L--P--L--S--L--L--K--N--L--G--Y--L--G--Y--T--S--G--
1081   TTTTCTCTTACCTGCATGGTGTTTTTTGTTAGTGTGGTGATTTACAAGAAATTCCAAATA   1140
       F--S--L--T--C--M--V--F--F--V--S--V--V--I--Y--K--K--F--Q--I--
1141   CCCTGCCCTCTACCTGTTTTGGATCACAGTGTTGGAAATCTGTCATTCAACAACACGCTT   1200
       P--C--P--L--P--V--L--D--H--S--V--G--N--L--S--F--N--N--T--L--
1201   CCAATGCATGTGGTAATGTTACCCAACAACTCTGAGAGTTCTGATGTGAACTTCATGATG   1260
       P--M--H--V--V--M--L--P--N--N--S--E--S--S--D--V--N--F--M--M--
1261   GATTACACCCACCGCAATCCTGCAGGGCTGGATGAGAACCAGGCCAAGGGCTCTCTTCAT   1320
       D--Y--T--H--R--N--P--A--G--L--D--E--N--Q--A--K--G--S--L--H--
1321   GACAGTGGAGTAGAATATGAAGCTCATAGTGATGACAAGTGTGAACCCAAATACTTTGTA   1380
       D--S--G--V--E--Y--E--A--H--S--D--D--K--C--E--P--K--Y--F--V--
1381   TTCAACTCCCGGACGGCCTATGCAATTCCTATCCTAGTATTTGCTTTTGTATGCCACCCT   1440
       F--N--S--R--T--A--Y--A--I--P--I--L--V--F--A--F--V--C--H--P--
1441   GAGGTCCTTCCCATCTACAGTGAACTTAAAGATCGGTCCCGGAGAAAAATGCAAACGGTG   1500
       E--V--L--P--I--Y--S--E--L--K--D--R--S--R--R--K--M--Q--T--V--
1501   TCAAATATTTCCATCACGGGGATGCTTGTCATGTACCTGCTTGCCGCCCTCTTTGGTTAC   1560
       S--N--I--S--I--T--G--M--L--V--M--Y--L--L--A--A--L--F--G--Y--
1561   CTAACCTTCTATGGAGAAGTTGAAGATGAATTACTTCATGCCTACAGCAAAGTGTATACA   1620
       L--T--F--Y--G--E--V--E--D--E--L--L--H--A--Y--S--K--V--Y--T--
1621   TTAGACATCCCTCTTCTCATGGTTCGCCTGGCAGTCCTTGTGGCAGTAACACTAACTGTG   1680
       L--D--I--P--L--L--M--V--R--L--A--V--L--V--A--V--T--L--T--V--
1681   CCCATTGTCCTCTTCCCAATTCGTACATCAGTGATCACACTGTTATTTCCCAAACGACCC   1740
       P--I--V--L--F--P--I--R--T--S--V--I--T--L--L--F--P--K--R--P--
1741   TTCAGCTGGATACGACATTTCCTGATTGCAGCTGTGCTTATTGCACTTAATAATGTTCTG   1800
       F--S--W--I--R--H--F--L--I--A--A--V--L--I--A--L--N--N--V--L--
1801   GTCATCCTTGTGCCAACTATAAAATACATCTTCGGATTCATAGGGGCTTCTTCTGCCACT   1860
       V--I--L--V--P--T--I--K--Y--I--F--G--F--I--G--A--S--S--A--T--
1861   ATGCTGATTTTTATTCTTCCAGCAGTTTTTTATCTTAAACTTGTCAAGAAAGAAACTTTT   1920
       M--L--I--F--I--L--P--A--V--F--Y--L--K--L--V--K--K--E--T--F--
1921   AGGTCACCCCAAAAGGTCGGGGCTTTAATTTTCCTTGTGGTTGGAATATTCTTCATGATT   1980
       R--S--P--Q--K--V--G--A--L--I--F--L--V--V--G--I--F--F--M--I--
1981   GGAAGCATGGCACTCATTATAATTGACTGGATTTATGATCCTCCAAATTCCAAGCATCAC   2040
       G--S--M--A--L--I--I--I--D--W--I--Y--D--P--P--N--S--K--H--H--
2041   TAAcacaaggaaaaatactttctttttctattggaaatggttacaagttatactccaaaa   2100
       ***.........................................................
2101   gatatttgaattatcttgattggaatgttattcataggaaataacaggaagattccaaag   2160
       ............................................................
2161   acgtttaccagtaatatcaccaggcacctgcagaagaggaaaatcactgtttttgtcaag   2220
       ............................................................
2221   gatggttgtgtatgtgtttaaaataaaacctgtggtgcacatttctacccaggttttgct   2280
       ............................................................
2281   agagcagtgtgagatgatgaaggtgtatttttgctgctttacgagcagaataagggtaac   2340
       ............................................................
2341   tgcatgtaacaatcatcagatagtactctttcccctgccgtctcctcatcctgcaccccc   2400
       ............................................................
2401   taaaaaagtaccaaacatttgcattctcagaacatcaaacaaaaatgccctggtggcaaa   2460
       ............................................................
2461   gctatcaccatttaatgtcttctctcagtcttgcaccaaagtctctggtctgtttactaa   2520
       ............................................................
2521   cagaggcaaaaggcatgtcttaggaactgtttctgtttctgtaaggtacatgaatggtca   2580
       ............................................................
2581   aacaccagtctagagcatcttattgtcaacagcaaaataatattttgcccaccctgtttg   2640
       ............................................................
2641   tgacattgagttgtgacttctatattcaatagatttttgtaaatgttaaaacatctatat   2700
       ............................................................
2701   ttaaatgttaaaacactaaatatagagaggggctttatttcaatcatagagcaacaacaa   2760
       ............................................................
2761   aaataatgcttatagctaaactgcctgttctagaaagcatctgctttttcatgttattcc   2820
       ............................................................
2821   taaatcctcttgtcatacttttgtcattgaacaatgctctccctctcgtcttccatcctc   2880
       ............................................................
2881   attcagaatttttagaagaccacaatcgtggagatacactacccagtattgtttgataca   2940
       ............................................................
2941   tttttatttgataaacattcagtgcaggaaactgtgatttgctatatgtttatgtatata   3000
       ............................................................
3001   atcttattctgtagtcatcagaatgttaatgtaaggtacatttgatttttattttttaca   3060
       ............................................................
3061   tgtgtagttttctttcttcacagtcaaagcatttatattattgggggtgggggcagggaa   3120
       ............................................................
3121   ttaagttggtgggctcgaaaatccattcatatgtatctgtctacaaatgtctggggataa   3180
       ............................................................
3181   tttaaatttgaaacctaagttatatatagtttggcaatgctcttcttcaatatttacaat   3240
       ............................................................
3241   aataggatgatctacaagaaaataagtttctttttgcaaatttttatcatactaaagttg   3300
       ............................................................
3301   ttcttttaatttagcatatctaaaataggatttagttcagtttagctcacacaggtgttt   3360
       ............................................................
3361   gctgacattcattggccatttaatacagtgttgagtggttctccgtaaaagtataagtgc   3420
       ............................................................
3421   taacactacgaagaaatgcacacgatcattcttgctcacttctataacaaacttacataa   3480
       ............................................................
3481   aatggatttaaaaattcctactcacagcctaaaacttctggagttcactacctttttttc   3540
       ............................................................
3541   aaatcatagtaagatcacttgtgtattttatattttagtaaagccaattatgaagtacaa   3600
       ............................................................
3601   gtatcatacacgtacttttgagctactattatttgaaaaaaatctgccaaatagcatctt   3660
       ............................................................
3661   taggatatatttacattttcactcatctaaaaagtatacaaaaataaaaagtggaaaaag   3720
       ............................................................
3721   gtatcttctgaatgttcaagagcatcctatagtgccaaataataaagcaccatttttttc   3780
       ............................................................
3781   ttcataaccaggattaaaattcatatatactgcagggcagacatacatatgatagcttgt   3840
       ............................................................
3841   gctgattaatttaaccccatttgtaaacagatgaaaattttattttcttatttcatttat   3900
       ............................................................
3901   aagatggctcaatgtattgggaggcttcttttttattacagaaagtgtatattggtatat   3960
       ............................................................
3961   aataaatgaacttttcaaatgacaaaaaaaaaaaaaaaa                        4020
       .......................................