Imprinted Gene Databases

Homo sapiens: INS

Species Gene Aliases Location Status Expressed Allele
Macropus eugenii INS     Imprinted Paternal
Equus caballus INS   12  Imprinted Paternal
Mus musculus Ins2 Mody, Ins-2, Mody4, AA986540, proinsulin, INS  7 69.1 cM  Imprinted Paternal
Homo sapiens INS ILPR, IRDN  11p15.5  Imprinted Paternal
1      agccctccaggacaggctgcatcagaagaggccatcaagcagatcactgtccttctgccA     60
361    CCCTCTACCAGCTGGAGAACTACTGCAACTAGacgcagcccgcaggcagccccacacccg    420
421    ccgcctcctgcaccgagagagatggaataaagcccttgaaccagcaaaa               480