Imprinted Gene Databases

Homo sapiens: OR11L1

Olfactory receptor, family 11, subfamily L, member 1

Luedi et al. Genome Res. 17: , 2007 PDF; Luedi et al. Genome Res. 17: , 2007 Supplement

Species Gene Aliases Location Status Expressed Allele
Homo sapiens OR11L1   1:247994229-248015197  Predicted Paternal
1      ATGGAGCCCCAAAATACCTCCACTGTGACTAACTTTCAGCTGTTAGGATTCCAGAACCTT     60
       M--E--P--Q--N--T--S--T--V--T--N--F--Q--L--L--G--F--Q--N--L--
61     CTTGAATGGCAGGCCCTGCTCTTTGTCATTTTCCTGCTCATCTACTGCCTGACCATTATA    120
       L--E--W--Q--A--L--L--F--V--I--F--L--L--I--Y--C--L--T--I--I--
121    GGGAATGTTGTCATCATCACCGTGGTGAGCCAGGGCCTGCGACTGCACTCCCCTATGTAC    180
       G--N--V--V--I--I--T--V--V--S--Q--G--L--R--L--H--S--P--M--Y--
181    ATGTTCCTCCAGCATCTCTCCTTTCTGGAGGTCTGGTACACGTCCACCACTGTGCCCCTT    240
       M--F--L--Q--H--L--S--F--L--E--V--W--Y--T--S--T--T--V--P--L--
241    CTCCTAGCCAACCTGCTGTCCTGGGGCCAAGCCATCTCCTTCTCTGCCTGCATGGCACAG    300
       L--L--A--N--L--L--S--W--G--Q--A--I--S--F--S--A--C--M--A--Q--
301    CTCTACTTCTTCGTATTCCTCGGCGCCACCGAGTGCTTTCTCCTGGCCTTCATGGCCTAT    360
       L--Y--F--F--V--F--L--G--A--T--E--C--F--L--L--A--F--M--A--Y--
361    GACCGTTACCTGGCCATCTGCAGCCCACTCCGCTACCCCTTCCTCATGCATCGTGGGCTC    420
       D--R--Y--L--A--I--C--S--P--L--R--Y--P--F--L--M--H--R--G--L--
421    TGTGCCAGGTTGGTGGTGGTCTCCTGGTGCACAGGGGTCAGCACAGGCTTTCTGCCTTCC    480
       C--A--R--L--V--V--V--S--W--C--T--G--V--S--T--G--F--L--P--S--
481    CTGATGATTTCCAGGTTGGACTTCTGTGGGCGCAATCAGATTAACCATTTCTTCTGCGAC    540
       L--M--I--S--R--L--D--F--C--G--R--N--Q--I--N--H--F--F--C--D--
541    CTCCCGCCACTCATGCAGCTCTCCTGTTCCAGAGTTTATATCACCGAGGTGACCATCTTC    600
       L--P--P--L--M--Q--L--S--C--S--R--V--Y--I--T--E--V--T--I--F--
601    ATCCTGTCAATTGCCGTGCTGTGCATTTGTTTTTTTCTGACACTGGGGCCCTATGTTTTC    660
       I--L--S--I--A--V--L--C--I--C--F--F--L--T--L--G--P--Y--V--F--
661    ATTGTGTCCTCCATATTGAGAATCCCTTCCACCTCTGGCCGGAGAAAGACCTTTTCCACA    720
       I--V--S--S--I--L--R--I--P--S--T--S--G--R--R--K--T--F--S--T--
721    TGTGGCTCCCACCTGGCTGTTGTCACTCTCTACTACGGGACCATGATCTCCATGTATGTG    780
       C--G--S--H--L--A--V--V--T--L--Y--Y--G--T--M--I--S--M--Y--V--
781    TGTCCCAGTCCCCACCTGTTGCCTGAAATCAACAAGATCATTTCTGTCTTCTACACTGTG    840
       C--P--S--P--H--L--L--P--E--I--N--K--I--I--S--V--F--Y--T--V--
841    GTCACACCACTGCTGAACCCAGTTATCTACAGCTTGAGGAACAAAGACTTCAAAGAAGCT    900
       V--T--P--L--L--N--P--V--I--Y--S--L--R--N--K--D--F--K--E--A--
901    GTTAGAAAGGTCATGAGAAGGAAATGTGGTATTCTATGGAGTACAAGTAAAAGGAAGTTC    960
       V--R--K--V--M--R--R--K--C--G--I--L--W--S--T--S--K--R--K--F--
961    CTTTATTAG                                                      1020
       L--Y--***