Imprinted Gene Databases

Homo sapiens: NKX6-2

NK6 homeobox 2

Luedi et al. Genome Res. 17: , 2007 PDF; Luedi et al. Genome Res. 17: , 2007 Supplement

Species Gene Aliases Location Status Expressed Allele
Homo sapiens NKX6-2 GTX, NKX6B, NKX6.2, MGC126684  10:134588319-134609536  Predicted Maternal
1      gccgcgcgcaaacttcccgggccggcgggcaggggcggcggcggcggggcccggatggga     60
       ............................................................
61     gcccgggccggcggcggcggcgcccATGGACACTAACCGCCCGGGCGCGTTCGTGCTGAG    120
       .........................M--D--T--N--R--P--G--A--F--V--L--S-
121    CAGTGCCCCGCTGGCCGCGCTGCACAACATGGCCGAGATGAAGACGTCGCTGTTCCCCTA    180
       -S--A--P--L--A--A--L--H--N--M--A--E--M--K--T--S--L--F--P--Y-
181    CGCGCTGCAGGGTCCGGCCGGCTTCAAGGCGCCCGCGCTGGGGGGCCTGGGCGCGCAGCT    240
       -A--L--Q--G--P--A--G--F--K--A--P--A--L--G--G--L--G--A--Q--L-
241    CCCGCTCGGGACCCCGCACGGCATCAGCGACATCCTGGGCCGGCCCGTGGGCGCGGCGGG    300
       -P--L--G--T--P--H--G--I--S--D--I--L--G--R--P--V--G--A--A--G-
301    CGGGGGCCTCCTGGGGGGGCTGCCCCGGCTCAACGGGCTCGCGTCGTCCGCCGGCGTTTA    360
       -G--G--L--L--G--G--L--P--R--L--N--G--L--A--S--S--A--G--V--Y-
361    CTTCGGGCCCGCGGCCGCTGTGGCGCGCGGCTACCCCAAGCCCCTGGCCGAGCTGCCGGG    420
       -F--G--P--A--A--A--V--A--R--G--Y--P--K--P--L--A--E--L--P--G-
421    GCGCCCGCCCATCTTCTGGCCCGGCGTGGTGCAGGGCGCGCCCTGGAGGGACCCGCGTCT    480
       -R--P--P--I--F--W--P--G--V--V--Q--G--A--P--W--R--D--P--R--L-
481    GGCTGGCCCGGCCCCGGCCGGCGGCGTCCTGGACAAGGACGGGAAGAAGAAGCACTCGCG    540
       -A--G--P--A--P--A--G--G--V--L--D--K--D--G--K--K--K--H--S--R-
541    CCCGACCTTCTCGGGCCAGCAGATCTTCGCGCTGGAGAAAACCTTCGAGCAGACCAAGTA    600
       -P--T--F--S--G--Q--Q--I--F--A--L--E--K--T--F--E--Q--T--K--Y-
601    CCTGGCGGGCCCGGAGCGCGCGCGTCTCGCCTACTCGCTGGGCATGACCGAGAGCCAGGT    660
       -L--A--G--P--E--R--A--R--L--A--Y--S--L--G--M--T--E--S--Q--V-
661    GAAGGTCTGGTTCCAGAACCGCCGGACCAAGTGGCGCAAGCGGCACGCGGCGGAGATGGC    720
       -K--V--W--F--Q--N--R--R--T--K--W--R--K--R--H--A--A--E--M--A-
721    GTCGGCCAAGAAGAAGCAGGACTCGGACGCCGAGAAGCTGAAGGTGGGCGGCTCGGACGC    780
       -S--A--K--K--K--Q--D--S--D--A--E--K--L--K--V--G--G--S--D--A-
781    GGAGGACGACGACGAATACAACCGGCCCCTGGACCCCAACTCGGACGACGAGAAGATCAC    840
       -E--D--D--D--E--Y--N--R--P--L--D--P--N--S--D--D--E--K--I--T-
841    GCGGCTGCTCAAGAAGCACAAACCCTCGAACTTGGCGCTGGTCAGCCCGTGCGGCGGCGG    900
       -R--L--L--K--K--H--K--P--S--N--L--A--L--V--S--P--C--G--G--G-
901    CGCGGGGGACGCCTTGTGAggacccgcggggtgggggcgaatctatttttgcagaatccg    960
       -A--G--D--A--L--***.........................................
961    ggggcggccccgggtgggcgcgagtcgctttgtatcatcaataaattatttaacgggtc    1020
       ...........................................................