Imprinted Gene Databases

Homo sapiens: LY6D

Lymphocyte antigen 6 complex, locus D

Luedi et al. Genome Res. 17: , 2007 PDF; Luedi et al. Genome Res. 17: , 2007 Supplement

Species Gene Aliases Location Status Expressed Allele
Homo sapiens LY6D E48  8:143856297-143878007  Predicted Paternal
1      gcccacccccgcccagcccgtgcctataaggccttggcaatgcaggggcccgcactgctc     60
       ............................................................
61     ccagacgacatcagagATGAGGACAGCATTGCTGCTCCTTGCAGCCCTGGCTGTGGCTAC    120
       ................M--R--T--A--L--L--L--L--A--A--L--A--V--A--T-
121    AGGGCCAGCCCTTACCCTGCGCTGCCACGTGTGCACCAGCTCCAGCAACTGCAAGCATTC    180
       -G--P--A--L--T--L--R--C--H--V--C--T--S--S--S--N--C--K--H--S-
181    TGTGGTCTGCCCGGCCAGCTCTCGCTTCTGCAAGACCACGAACACAGTGGAGCCTCTGAG    240
       -V--V--C--P--A--S--S--R--F--C--K--T--T--N--T--V--E--P--L--R-
241    GGGGAATCTGGTGAAGAAGGACTGTGCGGAGTCGTGCACACCCAGCTACACCCTGCAAGG    300
       -G--N--L--V--K--K--D--C--A--E--S--C--T--P--S--Y--T--L--Q--G-
301    CCAGGTCAGCAGCGGCACCAGCTCCACCCAGTGCTGCCAGGAGGACCTGTGCAATGAGAA    360
       -Q--V--S--S--G--T--S--S--T--Q--C--C--Q--E--D--L--C--N--E--K-
361    GCTGCACAACGCTGCACCCACCCGCACCGCCCTCGCCCACAGTGCCCTCAGCCTGGGGCT    420
       -L--H--N--A--A--P--T--R--T--A--L--A--H--S--A--L--S--L--G--L-
421    GGCCCTGAGCCTCCTGGCCGTCATCTTAGCCCCCAGCCTGTGAccttccccccagggaag    480
       -A--L--S--L--L--A--V--I--L--A--P--S--L--***.................
481    gcccctcatgcctttccttccctttctctggggattccacacctctcttccccagccgca    540
       ............................................................
541    acgggggtgccaggagccccaggctgagggcttccccgaaagtctgggaccaggtccagg    600
       ............................................................
601    tgggcatggaatgctgatgacttggagcaggccccacagaccccacagaggatgaagcca    660
       ............................................................
661    ccccacagaggatgcagcccccagctgcatggaaggtggaggacagaagccctgtggatc    720
       ............................................................
721    cccggatttcacactccttctgttttgttgccgtttatttttgtactcaaatctctacat    780
       ............................................................
781    ggagataaatgatttaaaccagaaaa                                      840
       ..........................