Imprinted Gene Databases

Homo sapiens: EGFL7

EGF-like-domain, multiple 7

Luedi et al. Genome Res. 17: , 2007 PDF; Luedi et al. Genome Res. 17: , 2007 Supplement

Species Gene Aliases Location Status Expressed Allele
Homo sapiens EGFL7 ZNEU1, MGC111117, VE-STATIN, RP11-251M1.2  9:139547376-139577129  Predicted Paternal
1      ccaagctggccctgcacggctgcaagggaggctcctgtggacaggccaggcaggtgggcc     60
       ............................................................
61     tcaggaggtgcctccaggcggccagtgggcctgaggccccagcaagggctagggtccatc    120
       ............................................................
121    tccagtcccaggacacagcagcggccaccatggccacgcctgggctccagcagcatcagc    180
       ............................................................
181    agcccccaggaccggggaggcacaggtggcccccaccacccggaggagcagctcctgccc    240
       ............................................................
241    ctgtccgggggatgactgattctcctccgccaggccacccagaggagaaggccaccccgc    300
       ............................................................
301    ctggaggcacaggccATGAGGGGCTCTCAGGAGGTGCTGCTGATGTGGCTTCTGGTGTTG    360
       ...............M--R--G--S--Q--E--V--L--L--M--W--L--L--V--L--
361    GCAGTGGGCGGCACAGAGCACGCCTACCGGCCCGGCCGTAGGGTGTGTGCTGTCCGGGCT    420
       A--V--G--G--T--E--H--A--Y--R--P--G--R--R--V--C--A--V--R--A--
421    CACGGGGACCCTGTCTCCGAGTCGTTCGTGCAGCGTGTGTACCAGCCCTTCCTCACCACC    480
       H--G--D--P--V--S--E--S--F--V--Q--R--V--Y--Q--P--F--L--T--T--
481    TGCGACGGGCACCGGGCCTGCAGCACCTACCGAACCATCTATAGGACCGCCTACCGCCGC    540
       C--D--G--H--R--A--C--S--T--Y--R--T--I--Y--R--T--A--Y--R--R--
541    AGCCCTGGGCTGGCCCCTGCCAGGCCTCGCTACGCGTGCTGCCCCGGCTGGAAGAGGACC    600
       S--P--G--L--A--P--A--R--P--R--Y--A--C--C--P--G--W--K--R--T--
601    AGCGGGCTTCCTGGGGCCTGTGGAGCAGCAATATGCCAGCCGCCATGCCGGAACGGAGGG    660
       S--G--L--P--G--A--C--G--A--A--I--C--Q--P--P--C--R--N--G--G--
661    AGCTGTGTCCAGCCTGGCCGCTGCCGCTGCCCTGCAGGATGGCGGGGTGACACTTGCCAG    720
       S--C--V--Q--P--G--R--C--R--C--P--A--G--W--R--G--D--T--C--Q--
721    TCAGATGTGGATGAATGCAGTGCTAGGAGGGGCGGCTGTCCCCAGCGCTGCGTCAACACC    780
       S--D--V--D--E--C--S--A--R--R--G--G--C--P--Q--R--C--V--N--T--
781    GCCGGCAGTTACTGGTGCCAGTGTTGGGAGGGGCACAGCCTGTCTGCAGACGGTACACTC    840
       A--G--S--Y--W--C--Q--C--W--E--G--H--S--L--S--A--D--G--T--L--
841    TGTGTGCCCAAGGGAGGGCCCCCCAGGGTGGCCCCCAACCCGACAGGAGTGGACAGTGCA    900
       C--V--P--K--G--G--P--P--R--V--A--P--N--P--T--G--V--D--S--A--
901    ATGAAGGAAGAAGTGCAGAGGCTGCAGTCCAGGGTGGACCTGCTGGAGGAGAAGCTGCAG    960
       M--K--E--E--V--Q--R--L--Q--S--R--V--D--L--L--E--E--K--L--Q--
961    CTGGTGCTGGCCCCACTGCACAGCCTGGCCTCGCAGGCACTGGAGCATGGGCTCCCGGAC   1020
       L--V--L--A--P--L--H--S--L--A--S--Q--A--L--E--H--G--L--P--D--
1021   CCCGGCAGCCTCCTGGTGCACTCCTTCCAGCAGCTCGGCCGCATCGACTCCCTGAGCGAG   1080
       P--G--S--L--L--V--H--S--F--Q--Q--L--G--R--I--D--S--L--S--E--
1081   CAGATTTCCTTCCTGGAGGAGCAGCTGGGGTCCTGCTCCTGCAAGAAAGACTCGTGActg   1140
       Q--I--S--F--L--E--E--Q--L--G--S--C--S--C--K--K--D--S--***...
1141   cccagcgccccaggctggactgagcccctcacgccgccctgcagcccccatgcccctgcc   1200
       ............................................................
1201   caacatgctgggggtccagaagccacctcggggtgactgagcggaaggccaggcagggcc   1260
       ............................................................
1261   ttcctcctcttcctcctccccttcctcgggaggctccccagaccctggcatgggatgggc   1320
       ............................................................
1321   tgggatcttctctgtgaatccacccctggctacccccaccctggctaccccaacggcatc   1380
       ............................................................
1381   ccaaggccaggtgggccctcagctgagggaaggtacgagctccctgctggagcctgggac   1440
       ............................................................
1441   ccatggcacaggccaggcagcccggaggctgggtggggcctcagtgggggctgctgcctg   1500
       ............................................................
1501   acccccagcacaataaaaatgaaacgtgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa   1560
       ............................................................
1561   aaaaaaaaa                                                      1620
       .........