Imprinted Gene Databases

Homo sapiens: C10orf93

Chromosome 10 open reading frame 93

Luedi et al. Genome Res. 17: , 2007 PDF; Luedi et al. Genome Res. 17: , 2007 Supplement

Species Gene Aliases Location Status Expressed Allele
Homo sapiens C10orf93 bB137A17.3, RP13-137A17.3  10:134732688-134766063  Predicted Maternal
1      ggagaacccaaccgacagtgggcggcaggacgcaccgcggaccccggagagagcggacga     60
       ............................................................
61     gcagggcgccggcgccATGGACCTGGTCATCACGCAGGAGCTGGCCCGCGCCGAGAGCCA    120
       ................M--D--L--V--I--T--Q--E--L--A--R--A--E--S--Q-
121    GCAAGATGCTGCGTCCTTGAAGAAGGCCTACGAGTTGATCAAATCGGCCAACCTAGGGAA    180
       -Q--D--A--A--S--L--K--K--A--Y--E--L--I--K--S--A--N--L--G--K-
181    ATCGGAGTTTGACCCCTCAGAGAGCTTCAGCCCAGACCTGTTTGTTCTGTGTGCAGAGCA    240
       -S--E--F--D--P--S--E--S--F--S--P--D--L--F--V--L--C--A--E--Q-
241    GGCCCTGAAGATGAGGCAGCCAGAGGTGAGCGAGGACTGCATCCAAATGTACTTCAAGGT    300
       -A--L--K--M--R--Q--P--E--V--S--E--D--C--I--Q--M--Y--F--K--V-
301    GAAGGCGCCCATCACCCAGTTTCTGGGCCGAGCGCACCTGTGCAGGGCCCAGATGTGTGC    360
       -K--A--P--I--T--Q--F--L--G--R--A--H--L--C--R--A--Q--M--C--A-
361    CCCGAAGTCGGCAGAAAACCTGGAGGAATTTGAAAATTGCGTGACTGAGTACATGAAGGC    420
       -P--K--S--A--E--N--L--E--E--F--E--N--C--V--T--E--Y--M--K--A-
421    CATAAACTTTGCCAAAGGAGAACCGAGGTACTACTTTTTGGTGTACAATGCATCAGTCCT    480
       -I--N--F--A--K--G--E--P--R--Y--Y--F--L--V--Y--N--A--S--V--L-
481    CTACTGGCAGATGGTGAGGCCGTTCCTCAAGCCTGGATATCGTCACCATCTGATCCCCAG    540
       -Y--W--Q--M--V--R--P--F--L--K--P--G--Y--R--H--H--L--I--P--S-
541    CCTTTCCCAAATCATAAACGTGCTGAGTCAGACTGAGGAGGAAGACAAGGAGTGGCGTGC    600
       -L--S--Q--I--I--N--V--L--S--Q--T--E--E--E--D--K--E--W--R--A-
601    TGAGCTGATGCTGGAACTTCTGGAGTGTTATCTGCAAGCCGGAAGAAAGGAGGAGGCTGC    660
       -E--L--M--L--E--L--L--E--C--Y--L--Q--A--G--R--K--E--E--A--A-
661    CAGGTTCTGCTCCACGGCAGCTCCGTTCATTAAGTCTCACGTGCCACAGAAATACCGGCA    720
       -R--F--C--S--T--A--A--P--F--I--K--S--H--V--P--Q--K--Y--R--Q-
721    GATATTCTCTGTTATGGTTCGTCATGAATTAATGGACGAACTTCAGTTAAAGGAAGAAAA    780
       -I--F--S--V--M--V--R--H--E--L--M--D--E--L--Q--L--K--E--E--K-
781    GAAAAATTCCATTAGCCTGTCAGTCACTTTCTATATTAATATGCTAAAGGCAAAAGCGGA    840
       -K--N--S--I--S--L--S--V--T--F--Y--I--N--M--L--K--A--K--A--E-
841    GCAAAATGATTTACCAGGTGACATCAATGTCATTCTGAGGAAGGCCTACAGACACTTAGG    900
       -Q--N--D--L--P--G--D--I--N--V--I--L--R--K--A--Y--R--H--L--G-
901    TCATTACAACCACCAGCGCTTTCCCTCTATCAGTGAAGAAAAAATGCTTTTGCTTTTTGA    960
       -H--Y--N--H--Q--R--F--P--S--I--S--E--E--K--M--L--L--L--F--E-
961    ATTGGCGCGTTTTTCCTTGACCTTGAAATGCATGGAGATCTCCTCTGCCTGCCTCTCAGA   1020
       -L--A--R--F--S--L--T--L--K--C--M--E--I--S--S--A--C--L--S--D-
1021   CCTGAAGAAGATGGAAAGCAAAGTAAGTGGCTTCATGACACTGCTGCCTGGGGATGAGGC   1080
       -L--K--K--M--E--S--K--V--S--G--F--M--T--L--L--P--G--D--E--A-
1081   GCTGCTCACCGTGCAGTTGGACAAAAGGCAAAGAAAGGAAGAGCAGTTCACCAGGCCACG   1140
       -L--L--T--V--Q--L--D--K--R--Q--R--K--E--E--Q--F--T--R--P--R-
1141   GCCCCCAGGGCTTCGGTCCGTGGTTGGCACATTGCCGTCTTTCCTACCTGTGTTTTGCAC   1200
       -P--P--G--L--R--S--V--V--G--T--L--P--S--F--L--P--V--F--C--T-
1201   AGTTGCAGTTAGATGGTGTTTGCAATTTTACACCTGCCCGTTTCTCTTTACCTTTCTTGT   1260
       -V--A--V--R--W--C--L--Q--F--Y--T--C--P--F--L--F--T--F--L--V-
1261   GGCCACGGGTCCACAGCACCACAGTTGTTTCTAGagtccaatttacggacggcgtaaaat   1320
       -A--T--G--P--Q--H--H--S--C--F--***..........................
1321   ttcatgatgctgatgatccagaacatcctccaccagtcccattattggacgtgtaaatca   1380
       ............................................................
1381   caccggcagtgcctcgttacccgcagttcactttctgcagtttgttacctgcagacagct   1440
       ............................................................
1441   acagtatgaaaatattaagctattctgagggagaggccacagccacatcacttctgttac   1500
       ............................................................
1501   agtatagtgttatgattgtatcttattattagttattgttataaatatcttattgtgcct   1560
       ............................................................
1561   aaaaaaa                                                        1620
       .......