Imprinted Gene Databases

Ovis aries: CDKN1C

Cyclin-dependent kinase inhibitor 1C
Species Gene Aliases Location Status Expressed Allele
Mus musculus Cdkn1c CDKI, Kip2, p57Kip2, AL024410, p57(kip2)  7 69.49 cM  Imprinted Maternal
Macropus eugenii CDKN1C     Not Imprinted Biallelic
Homo sapiens CDKN1C BWS, WBS, p57, BWCR, KIP2  11p15.5  Imprinted Maternal
Ovis aries CDKN1C CDKN1C    Imprinted
1      gccagaggacgagacaATGCGGCCAGCGGCCGGACGACACCGCGAGCGAGCCTCAGGAGC     60
       ................M--R--P--A--A--G--R--H--R--E--R--A--S--G--A-
61     AGTCAGCGGCCCGACAGCCAGAGCATTGGCAATGGAGCGCCTGGTCGCCCGCCGCACCTT    120
       -V--S--G--P--T--A--R--A--L--A--M--E--R--L--V--A--R--R--T--F-
121    TCCCATGATCGCGCGCACCAGCGCCTGCCGCAGCCTCTTCGGGCCCGTGGACCACGAGGA    180
       -P--M--I--A--R--T--S--A--C--R--S--L--F--G--P--V--D--H--E--E-
181    GCTGGGCCGTGAGCTGCAGATGCGCCTGGCCGAGCTGAGCGCCGAGGACCAGCGTCGCTG    240
       -L--G--R--E--L--Q--M--R--L--A--E--L--S--A--E--D--Q--R--R--W-
241    GGACTACAACTTCCAGCTGGACATGCCACTGCGGGGCCCCGGGCGCCTGCAGTGGACCGA    300
       -D--Y--N--F--Q--L--D--M--P--L--R--G--P--G--R--L--Q--W--T--E-
301    GGTGGACAGCGACTCCGTGCCCGCCTTCTATCGCGAGACGGTGCAGGTGGGGCGCTGTCG    360
       -V--D--S--D--S--V--P--A--F--Y--R--E--T--V--Q--V--G--R--C--R-
361    CCTGCTCCTGGCGCCTCGTCCCCGCCCGGACGGCGCGGTCAATAGCCCGCCTCCCGGGCC    420
       -L--L--L--A--P--R--P--R--P--D--G--A--V--N--S--P--P--P--G--P-
421    GCCGGCCGATGAGTCCCTCGACGGCCTCGAGGAGGCGCCGGCGTCGCCGTCCAGCGGCCC    480
       -P--A--D--E--S--L--D--G--L--E--E--A--P--A--S--P--S--S--G--P-
481    GGCCGTAGCGCCTGCCCAGGCCGCGGCCCCGGCGCCTCAGGAGGGCGCTGAGCAGGAGGC    540
       -A--V--A--P--A--Q--A--A--A--P--A--P--Q--E--G--A--E--Q--E--A-
541    GGTCCCGCCGCCGCGCGGCCAGGAGCCCCAGGCCGAGCCGCCGCACTCAGGGATTTCGGG    600
       -V--P--P--P--R--G--Q--E--P--Q--A--E--P--P--H--S--G--I--S--G-
601    GCGCCCCGCGCCGGGCACTGCCGCCGCTGCCACCAACACCGCCGCCAGCGGCGCCGCTGT    660
       -R--P--A--P--G--T--A--A--A--A--T--N--T--A--A--S--G--A--A--V-
661    TGCCACCACTGCCGCCGCCGGAGGCGCCGCGATCAAGAAGCTGTCCGGGCCTCTCATCTC    720
       -A--T--T--A--A--A--G--G--A--A--I--K--K--L--S--G--P--L--I--S-
721    CGACTTCTTCGCCAAGCGCAAGAGACCCGCGCCCGAAACCAAGGCGTCGAACGATGTTCC    780
       -D--F--F--A--K--R--K--R--P--A--P--E--T--K--A--S--N--D--V--P-
781    CGCGGGATGCGCCGCGCCTGGCGCCGCTCCAGCCGTCGGCTCGGCTGAGCAAACCCCGCG    840
       -A--G--C--A--A--P--G--A--A--P--A--V--G--S--A--E--Q--T--P--R-
841    CAAGCGGCTGCGATGAgagcctcgtgcccaaagagccctgacggagcccgttgggcagcg    900
       -K--R--L--R--***............................................
901    gacaggagaggagcgctgggcctcggctgggaccgtccatgtagcagcaaccggcggcag    960
       ............................................................
961    ctgccgcgagcagcgttcggtttcgtgtttaaagtttgacaactgtgcaatgtattaata   1020
       ............................................................
1021   acgtcttttatatctaaatgtattctgcccaaggagtacactggtcccaggtgtaaagct   1080
       ............................................................
1081   tttagagtcatttatataaaatgttaatctctgctgaactcagtgcaaaaaaaatgaaaa   1140
       ............................................................
1141   agccaaaaaaaaggaaaaaagaaaaaaaaccctgtatatttgtacaaaaagtttttaaag   1200
       ............................................................
1201   ttatactaacttatattttctatttatgtggaggcgtgggccgctctgccacgccgcagc   1260
       ............................................................
1261   tcggttattggttatgccaaaggcacctcactcgcatctggttatcagcaaatgtaaatc   1320
       ............................................................
1321   tattttttgtagcgtattctgggggaggggtcactcacaagctatagctgccgtacaagc   1380
       ............................................................
1381   ccatctagcttgcagtctcttcgcgctttcgctgtctcttcttactattatgattatttt   1440
       ............................................................
1441   aaactggaagacaaatctgtttttttaaaaaatggttcctgagccgtctgcaccactgcc   1500
       ............................................................
1501   ccggctcctcgtccgccgggttctaaataaagaggccgaaaaaatgctgcaaaaaaaaaa   1560
       ............................................................
1561   aaaaaaaaaaaaa                                                  1620
       .............