Imprinted Gene Databases

Homo sapiens: NTM

Neurotrimin

Luedi et al. Genome Res 17: 1723-1730, 2007 PDF; Luedi et al. Genome Res 17: 1723-1730, 2007 Supplement; Barbaux et al. Epigenetics 7:1079; Genomic sequence is not displayed because it is too large.

Species Gene Aliases Location Status Expressed Allele
Mus musculus Ntm Hnt, Igdcc2, R75390, 6230410L23Rik, B230210G24Rik  9:28985963-29973128  Imprinted
Homo sapiens NTM HNT, NTRI, IGLON2  11:131230370-132216715  Imprinted Maternal
1      gcggccgcagcgcgcatttgggctccgaggaagttgaccgaggcggctgccgcaggatcc     60
       ............................................................
61     cgggcccggatcgcacgaagcccgcgcggccgtctcctccgcgcgccacccctgcgcctc    120
       ............................................................
121    ccgcgagctccacttcccatctgctattgtttccgattgttttccggtggcgagcccggc    180
       ............................................................
181    tccgaaacttacaaagtgttggatgtcccccgttcgaactgagggactgcagaccgcctc    240
       ............................................................
241    tgggtagctggatgaagcccaccccgtccccttctggtaccaaagtgcttactcctctcc    300
       ............................................................
301    aaagtgccgtgtctgaactgccgctgggaagaagcggctcctgagacgcgcccacacctt    360
       ............................................................
361    tcacctgccgcgcgcttccccctcctcggccaccttcccggcggaagcagcgaggaggga    420
       ............................................................
421    gccccctttggccgtcctccgtggaaccggttttccgaggctggcaaaagccgaggctgg    480
       ............................................................
481    atttgggggaggaatattagactcggaggagtctgcgcgcttttctcctccccgcgcctc    540
       ............................................................
541    ccggtcgccgcgggttcaccgctcagtccccgcgctcgctccgcaccccacccacttcct    600
       ............................................................
601    gtgctcgcccggggggcgtgtgccgtgcggctgccggagttcggggaagttgtggctgtc    660
       ............................................................
661    gagaATGGGGGTCTGTGGGTACCTGTTCCTGCCCTGGAAGTGCCTCGTGGTCGTGTCTCT    720
       ....M--G--V--C--G--Y--L--F--L--P--W--K--C--L--V--V--V--S--L-
721    CAGGCTGCTGTTCCTTGTACCCACAGGAGTGCCCGTGCGCAGCGGAGATGCCACCTTCCC    780
       -R--L--L--F--L--V--P--T--G--V--P--V--R--S--G--D--A--T--F--P-
781    CAAAGCTATGGACAACGTGACGGTCCGGCAGGGGGAGAGCGCCACCCTCAGGTGCACTAT    840
       -K--A--M--D--N--V--T--V--R--Q--G--E--S--A--T--L--R--C--T--I-
841    TGACAACCGGGTCACCCGGGTGGCCTGGCTAAACCGCAGCACCATCCTCTATGCTGGGAA    900
       -D--N--R--V--T--R--V--A--W--L--N--R--S--T--I--L--Y--A--G--N-
901    TGACAAGTGGTGCCTGGATCCTCGCGTGGTCCTTCTGAGCAACACCCAAACGCAGTACAG    960
       -D--K--W--C--L--D--P--R--V--V--L--L--S--N--T--Q--T--Q--Y--S-
961    CATCGAGATCCAGAACGTGGATGTGTATGACGAGGGCCCTTACACCTGCTCGGTGCAGAC   1020
       -I--E--I--Q--N--V--D--V--Y--D--E--G--P--Y--T--C--S--V--Q--T-
1021   AGACAACCACCCAAAGACCTCTAGGGTCCACCTCATTGTGCAAGTATCTCCCAAAATTGT   1080
       -D--N--H--P--K--T--S--R--V--H--L--I--V--Q--V--S--P--K--I--V-
1081   AGAGATTTCTTCAGATATCTCCATTAATGAAGGGAACAATATTAGCCTCACCTGCATAGC   1140
       -E--I--S--S--D--I--S--I--N--E--G--N--N--I--S--L--T--C--I--A-
1141   AACTGGTAGACCAGAGCCTACGGTTACTTGGAGACACATCTCTCCCAAAGCGGTTGGCTT   1200
       -T--G--R--P--E--P--T--V--T--W--R--H--I--S--P--K--A--V--G--F-
1201   TGTGAGTGAAGACGAATACTTGGAAATTCAGGGCATCACCAGGGAGCAGTCAGGGGACTA   1260
       -V--S--E--D--E--Y--L--E--I--Q--G--I--T--R--E--Q--S--G--D--Y-
1261   CGAGTGCAGTGCCTCCAATGACGTGGCCGCGCCCGTGGTACGGAGAGTAAAGGTCACCGT   1320
       -E--C--S--A--S--N--D--V--A--A--P--V--V--R--R--V--K--V--T--V-
1321   GAACTATCCACCATACATTTCAGAAGCCAAGGGTACAGGTGTCCCCGTGGGACAAAAGGG   1380
       -N--Y--P--P--Y--I--S--E--A--K--G--T--G--V--P--V--G--Q--K--G-
1381   GACACTGCAGTGTGAAGCCTCAGCAGTCCCCTCAGCAGAATTCCAGTGGTACAAGGATGA   1440
       -T--L--Q--C--E--A--S--A--V--P--S--A--E--F--Q--W--Y--K--D--D-
1441   CAAAAGACTGATTGAAGGAAAGAAAGGGGTGAAAGTGGAAAACAGACCTTTCCTCTCAAA   1500
       -K--R--L--I--E--G--K--K--G--V--K--V--E--N--R--P--F--L--S--K-
1501   ACTCATCTTCTTCAATGTCTCTGAACATGACTATGGGAACTACACTTGCGTGGCCTCCAA   1560
       -L--I--F--F--N--V--S--E--H--D--Y--G--N--Y--T--C--V--A--S--N-
1561   CAAGCTGGGCCACACCAATGCCAGCATCATGCTATTTGGTCCAGGCGCCGTCAGCGAGGT   1620
       -K--L--G--H--T--N--A--S--I--M--L--F--G--P--G--A--V--S--E--V-
1621   GAGCAACGGCACGTCGAGGAGGGCAGGCTGCGTCTGGCTGCTGCCTCTTCTGGTCTTGCA   1680
       -S--N--G--T--S--R--R--A--G--C--V--W--L--L--P--L--L--V--L--H-
1681   CCTGCTTCTCAAATTTTGAtgtgagtgccacttccccacccgggaaaggctgccgccacc   1740
       -L--L--L--K--F--***.........................................
1741   accaccaccaacacaacagcaatggcaacaccgacagcaaccaatcagatatatacaaat   1800
       ............................................................
1801   gaaattagaagaaacacagcctcatgggacagaaatttgagggaggggaacaaagaatac   1860
       ............................................................
1861   tttggggggaaaaaagttttaaaaaagaaattgaaaattgccttgcagatatttaggtac   1920
       ............................................................
1921   aatggagttttcttttcccaaacgggaagaacacagcacacccggcttggacccactgca   1980
       ............................................................
1981   agctgcatcgtgcaacctctttggtgccagtgtgggcaagggctcagcctctctgcccac   2040
       ............................................................
2041   agagtgcccccacgtggaacattctggagctggccatcccaaattcaatcagtccataga   2100
       ............................................................
2101   gacgaacagaatgagaccttccggcccaagcgtggcgctgcgggcactttggtagactgt   2160
       ............................................................
2161   gccaccacggcgtgtgttgtgaaacgtgaaataaaaagagcaagaaagaaaaaggaaaca   2220
       ............................................................
2221   aaataagaccgtctgacagcaacaacggtcccacaaacaagtcacaaaagataccgttaa   2280
       ............................................................
2281   acttttttttttttttatcattttactacatgaacatcatggataacaagggattctgat   2340
       ............................................................
2341   tcattattaatttcattaattatattttctgatatgagtctagaacttactgcaaaaaca   2400
       ............................................................
2401   agacaaaactaaaaaaatacaactgagaagggtgaagagaagtatgtttgttaaacagta   2460
       ............................................................
2461   aaaatgaatagtatacttcttaactaggtttacaactggtggaccacacaccaggcacta   2520
       ............................................................
2521   atcacctggtgaggatttggcatatccaccaaaaaatgcatccgatttaaccaacatctc   2580
       ............................................................
2581   caccagcgctacggactcctcccaattctgacatctcttgcagacaatactatgctctct   2640
       ............................................................
2641   acacactgtttagaaatggaaaggtgatctgcactgtatcttgggtttgttggctatgct   2700
       ............................................................
2701   tcctttgatgacatatattatacagtatatatatacatatattttttttgttagagttct   2760
       ............................................................
2761   agccattttatttctccgcagggtcctttctcagacattactgcatgctgtatatggcgt   2820
       ............................................................
2821   tagctgtgtgttgatcttctaaaagatgatagagtttactggtaattgtgtaatcagctc   2880
       ............................................................
2881   ctgcctttttattttcttgggttatttacatgtcagagacatttataaaaagtgaaagga   2940
       ............................................................
2941   taaaaaaaaaaaaaaacaactaataccgggcgcagcatctttccaggtgtggctctgcgc   3000
       ............................................................
3001   taggccaccccaggtggccccgctttctccattctgccctgtggcgttaacagacagcaa   3060
       ............................................................
3061   gcagctgaacaagcagtaccgtcagtacccacttgctttagcccattatgggaatctctg   3120
       ............................................................
3121   atgcctttgtgaccactggagagtttaatcctcttggtttattttatttcccacctttgt   3180
       ............................................................
3181   gtgagtgtgtatgaaagagaagaaaatgcaatttttaggtaatcttttttttttttcccc   3240
       ............................................................
3241   tcccctgaaagtctgggaacctgagagtcctcggggaggggtcctggatgtgatgaggga   3300
       ............................................................
3301   aagggggattgggggatccgggagggtggggttgtctctgacttgacattaaaaagtgtt   3360
       ............................................................
3361   ccatgtccctcttcaaaaaaa                                          3420
       .....................