Imprinted Gene Databases

Monodelphis domestica: L3MBTL

l(3)mbt-like 1 (Drosophila)

Radhika Das, PhD Thesis: Identification of Novel Imprinted Domains in the Therian Lineage

Species Gene Aliases Location Status Expressed Allele
Monodelphis domestica L3MBTL 1:385894556-385957809:-1  Imprinted Paternal
Mus musculus L3mbtl L3MBTL1, KIAA0681, mKIAA0681, C630004G01  2 H2  Not Imprinted Biallelic
Homo sapiens L3MBTL L3MBTL1, FLJ41181, KIAA0681, H-L(3)MBT, dJ138B7.3, DKFZp586P1522  20q13.12  Imprinted Paternal
acggctccgcgccagggctgcaaaggcggggcgggggcggcggctcgggg
tgggcgcgggctggcgagcctggagcggtgcctggggcgccggcgcgggc
ttgggagctgtccccgctgagtgcgcttgggccgagcctggccaggggtg
ccgggagccttcgggaggggaagtttgcaaggatttacctttttttctag
agtgggggaggggggaatggagtagctgatgtttgcaggagagaggggag
agaaatggggggagggggaagcctaggagaggaccagatagatgcatgcc
gagagagaagagccaaggttctgggcctgtccgcagccagtaaatatacc
tacggtaagagtcaatagggatgagtcaggcccaggtttgggggagctca
tttcctggagcccgatttccacagagctgacagttgcttttctattgggg
ggcttgtgtgcaggtggttggtggggcccttcagtggcccATGGATGGGA
GAGTGGAGATGGAGATGTTGAGGACCCTGAAGGGCACTGCTGCTGGGGAG
GTCAGCGTCCACCTGGTTGCCAACGACAGCACTGGCCACCTGCCTGCCAC
CACCTTCATCATCCCAGCCAACACCACCACCATCAGCCTCCCCAGCAATA
CCTTAGAGATCCCGCGCTTCCCCAGGGAGTCTACCAGAGCAGGAGGATCC
GAGAGGGCCCCGGGGAGCGAGCCCGTCACCGCCACGGTGCTCCCACAGCT
CAGCTCGGGCCCGCCTGGCAACACCGTCCGCGTGCTAGAGTGGAAGGATG
GGGCCACCTCCCTGCCTGGGAGCAACCTACGGCTGCGGATCAGTGACTAT
GGAACCCTGAAGGTGGTGGGGACAGACAAGATAACCGCCCAGGAGCTGCT
CCGAGAAGACTCGGACCCAGACAGAGCCCCTCCAGCCCCAACAGGTGGTG
AATGCCCTCCGGGGCGCCAAGATGAGGAAACTTTGGGCCATTGCCACATG
TGTGGGCGACAGAATGTATCAGGGCAAATCAGGGGTTTCTGTAGCGAGCA
GTGCCATCGACAATTCAAAGAACGGTCTGTGATTGTGGAGAACTCGGGGG
GCAGCACCAACACATCCGAGCTCCTGAAGCCTGTGAAGAAGAGGAAAAGG
AAGGAATACCAGAGTCCCTCTGAGGAAGAATCCGAGCCTGAACCTCTGGA
GAAGCAAGAAGAACGGAAGAGCCTGGAAGCTGAGCCTAACGCTGACACCC
CCGAGAGTGAGGAATGGAGTAGCCAGCCTGGTATGTTGTTCACAGAACCA
TATATGCTGCTTTCAGGGCCTTTGTGTCAGCAGCATCAATCGGGTACCCC
TAAAACTAAGGCTTTTGCCAACATTCTAAGAATATTACAACCATTCTGCT
GGTATCTCTGCTTAAATCACACAGAGTACTGTGATCAATGGGAATACTTG
TTCACACATCCATATATAAAAGATGATTCCTGTCTTCAAGGAGCTCATAG
TCTAATGGAGGAGACAACATGCAAACAACTGGACAAACAGACAATCAACA
GAAGGAATGCACTAGAATTAAGGGGAATTGAGAAGGCTTTTGAGAAGTGC
CAAGCTTTCCCTCATAACAAGAATGGCTTCAAACTGGGCATGAAGCTGGA
AGGGATTGACCCTCAGCACCCATCCATGTATTTCATCCTCACTGTGGTGG
AGGAGAATAGTGGTGTGCGGGCCATGGGGATGAGTCAAGAAAAAGATCAG
ATTTTTAGCAGGAAGAATGAAGAGGAATATCCTGTACTCATTTTGGGAAA
TGATGAACTTGAGATGCCAAGTGGGCATCCAGTGGGAGTTATCCTTGGGC
TGGTGGTGATGGAAGTCAAGAAGAGGGATTTAAAGTTGAGAATCACCCCC
GTAGAGGTGATACTTGAAGCCCTGGGAGTAGAAGTCTGCCAAAGGAGAGA
ATTTAAAGTTTGTGGGTACCGAATGCGTCTGCACTTTGATGGCTACTCTG
AGTGCCATGACTTCTGGCTCAATGCTGATTCCCCCAACATCCACCCGGCT
GGCTGGTTTGAGAAGACTGGACACAGGCTACAGCCCCCAAAAGGTTACAA
GGAGGAGGAGTTCAGCTGGAGCAACTACCTGCGGAGCACCAAGGCCCAGG
CTGCCCCCAAGCACCTGTTTGCCAGCCATAGCAACAGCTCAGTGCCCACA
GGCTTCCAGGTGGGCATGAAGCTGGAGGCTGTGGACCGCATGAACCCCTC
CCTCATCTGCGTGGCCAGTGTCACCGACGTGGTGAATGGTCGTTTCTTGG
TGCACTTTGACAACTGGGACGACACCTATGATTACTGGTGTGACCCCAGC
AGTCCTTATATCCACCCTGTTGGCTGGTGCCAGAAGCAAGGAAAACCCCT
CACACCTCCACAAGATTATCCAGATCCTGATAGTTTTTGCTGGGAAAAGT
ACCTAGAAGAAACTGGAACCTCTGCCGTCCCTTCCTGGGCCTTCAAAGTG
CGACCACCCCATGGCTTCCTCATCAACATGAAGCTTGAAGCTGTGGACCG
AAGAAGCCCAGCTCTGATTCGAGTGGCCAGTGTGGAGGATGTAGAAGACC
ACAGGATAAAGCTCCACTTTGATGGCTGGAGTCATGCCTATGACTTTTGG
ATTGATTCTGACCATCCTGACATACACCCTGTGGGCTGGTGCTCCAAGAC
TGGCCATCCCCTACAGCCCCCACTCAGACCCAGAGAACCCAACTCTTCTT
CTCCTGGGGGCTGCCCCCCACTCAGCTGTAAGAGTCCACCCCATGTTAAG
ACCTCCAAGTACAGTTTTCACCACAGGAAGTGCCCCACACCTGGCTGTGA
TGGCTCTGGCCACGTCACCGGAAAGTTCACAGCACATCATTGCCTCTCTG
GCTGCCCACTGGCCGAGAGGAACCAGGGCCGACTGAAAACGGAGCTGTCG
GACACCGAGGCCTCTGCACGCAAGAGGAACCTCATTGGCTTCGCCCCCAG
GAAGAAATCCCGTCACCACGGCCGGATTGGGCGTCCTCCAAAGTACCGGA
AAATCCAGCAGGATGACTTCCCGGCTTTGCCCCCCGACAACACGCACCAA
TCCTTCTTCATGTCGGCCTTGCCAGCTCACCCTGGTCGTTCTTTGTCCAC
ATGCTGGGAGCAACATTGCAAACTGCTACCGGGGATAGCAAGCGTCAATG
CAGCATCGGTGACCAAATGGACTATCGAGGAGGTCTTCAGCTTTGTCCAG
ATTCTGACAGGTTGTGATGAACAAGCTAAACTCTTCAGAGATGAGAAGAT
TGATGGCGAGGCCTTCCTTTTGCTGACCCAGGCGGACATCGTGAAGATCA
TGTGTATTAAGCTGGGCCCAGCCCTGAAGATCTATAATGCCATTCTCATG
TTCAGAAATGCCGACGATACCTTAAAGGACTGGGAGCTCTTTGCCGAGGG
AGACAGACCCCTGAACAGAGAAAGCCCTGTGTCTATCTACCTTGTACTTC
ATGGGAAAGTGTCTTCAGCTACAGTTCTACCAAGGCATCCCCCTCCAAAG
CCAAAGCAGGAATCTCCAGAACTAATCTCTCCAGAAGCCAGGAAAGGAAG
GTCAGCTATTTACCCACCCAAGATGAACTCCAAAGGAGAAGACAGAAGGT
CAAATCCCAAGGTGAAGTTCTCCAACACTGAAGTCCAAAGAAGATCCCGG
AGCAGTCCTCCAAGAAGCAGTCCCAGTGGCAAGGTCGAAGGTCCAAGGAA
AGAAGAAAACCAAATTAACAGCATCATAGATGAAAAGGGAGAGCTCACCT
CCAATGAAGAGGAAATTAAGGCAATCATTAAAAACTATTTTGCCCAATTA
TATGGCAATAAATATGCCAATCTAGGTGATATGGATGAATATTTACAAAA
ATATAAATTGCCTAGATTAACAGAAGAAGAAATAGAATTCTTAAATAATC
CCATATCAGAAAAAGAAATCGAACAGGTCATCAAAGAACTCCCTAAGAAA
AAATCCCCAGGACCTTATGGATTCACAAGTGAATTCTATCAAATATTCAA
AGAACATATGATCCCAATATTATACAAACTATTTGACATAATAAGCAAAG
AGGGGGTTCTACAAAATTCCTTTTATGACACAAATATGGTACTGATTCCA
AAGGCAGGCAGGTCAAAAACAGAGAAAGAAAACTACAGACCAATCTCCCT
AATGAACATAGATGCAAAAATCTTAAATAGGATACTAGCAAAGAGACTCC
AGCAAATGATCAGGAGGGTTATTCACTATGATCAGGTGGAATTTATACCA
GGAATGCAAGGATGGTTCAATATTAGGAAAACTATCCACATAATTGACCA
TATCAACAAGCAAACCAACAAAAAATCACATGATCATCTCAATAGACGCA
GAAAAAGCCTTTGA